RNA molecular weight formula
MW = (A × 329.209) + (C × 305.183) + (G × 345.208) + (U × 306.167) + end group
Each number is a nucleoside monophosphate minus one water. It is the mass that one nucleotide adds to the chain.
The end group includes the 3'-OH. It is +18.015 for a 5'-monophosphate, +177.973 for a 5'-triphosphate, and −61.964 for a 5'-OH oligo.
| Nucleotide | Residue formula | Residue mass (g/mol) |
|---|---|---|
| A (adenosine) | C10H12N5O6P | 329.209 |
| C (cytidine) | C9H12N3O7P | 305.183 |
| G (guanosine) | C10H12N5O7P | 345.208 |
| U (uridine) | C9H11N2O8P | 306.167 |
RNA molecular weight from length
When only the length is known, MW ≈ length × 321.442 + end group. The value 321.442 g/mol is the mean residue mass for equal A, C, G, and U.
A 1,000-nt in vitro transcript with a 5'-triphosphate is about 321,620 g/mol, or 321.6 kDa.
RNA mass to moles
pmol = µg × 1,000,000 ÷ MW (g/mol)
| RNA | Length | Molecular weight (g/mol) | pmol in 1 µg |
|---|---|---|---|
| siRNA strand, 5'-OH (GCAAGCUGACCCUGAAGUUCA) | 21 nt | 6,695.1 | 149.4 |
| In vitro transcript, 5'-triphosphate | 1,000 nt | 321,620 | 3.11 |
| Long mRNA, 5'-triphosphate | 5,000 nt | 1,607,387 | 0.622 |
How to use this calculator
- Choose Sequence, or Length only for a long transcript.
- Paste the RNA sequence with A, C, G, and U.
- Select the 5' end: hydroxyl, monophosphate, or triphosphate.
- Calculate the molecular weight, formula, and picomoles per microgram.
Formula and variables
MW = Σ(nᵢ × residueᵢ) + end group
| Symbol | Meaning | Unit |
|---|---|---|
| nᵢ | number of each nucleotide | count |
| residueᵢ | nucleotide residue mass | g/mol |
| end group | 5' and 3' end groups | g/mol |
Worked example
The 5'-OH RNA ACGU has residues 329.209 + 305.183 + 345.208 + 306.167 = 1285.767 g/mol. The −61.964 end group gives 1223.803 g/mol.
Interpretation
The result is the neutral free-acid form. Salts, modified bases, and dye labels change the mass.
Common mistakes
- Use U, not T, for uracil in RNA.
- Select the 5' end that matches how the RNA was made.
- Do not use the length-only estimate when the sequence is known.
Frequently asked questions
How do you calculate RNA molecular weight?
Add the residue mass of each nucleotide in the chain. Then add the end group for the 5' end and the 3'-OH.
What is the average molecular weight of an RNA nucleotide?
It is about 321.4 g/mol per nucleotide for equal A, C, G, and U. Use the sequence for an exact value.
Why does the 5' end change the molecular weight?
A 5'-triphosphate adds about 160 g/mol over a monophosphate. A 5'-OH removes one phosphate, about 80 g/mol.
Does the calculator include counterions?
No. It reports the neutral free-acid form. A sodium salt adds about 22 g/mol for each phosphate.
How do I convert micrograms of RNA to picomoles?
Multiply the mass in micrograms by 1,000,000. Then divide by the molecular weight in g/mol.
Can I use scientific notation?
Yes. Enter values such as 6.022e23 or 1.0e-6 in a numeric field.
How should I round the result?
Keep extra digits during the calculation. Round the final result to the precision required by your data.