DNA molecular weight formula
MW = (A × 313.210) + (C × 289.184) + (G × 329.209) + (T × 304.195) + end group
Each number is a deoxynucleoside monophosphate minus one water. The end group is −61.964 for a 5'-OH oligo, +18.015 for a 5'-monophosphate, and +177.973 for a 5'-triphosphate.
| Nucleotide | Residue formula | Residue mass (g/mol) |
|---|---|---|
| dA (deoxyadenosine) | C10H12N5O5P | 313.210 |
| dC (deoxycytidine) | C9H12N3O6P | 289.184 |
| dG (deoxyguanosine) | C10H12N5O6P | 329.209 |
| dT (thymidine) | C10H13N2O7P | 304.195 |
Double-stranded DNA and plasmids
Double-stranded DNA contains the entered strand and its complement. The mean mass is about 617.8 g/mol per base pair.
A circular plasmid has no free 5' or 3' ends, so it has no end groups. A 2,686 bp plasmid such as pUC19 is about 1.66 MDa.
| DNA | Length | Molecular weight (g/mol) | pmol in 1 µg |
|---|---|---|---|
| Primer, 5'-OH (AGCTGACCTGAAGTTCATCT) | 20 nt | 6,092.0 | 164.1 |
| PCR product, 5'-OH ends | 1,000 bp | 617,775 | 1.62 |
| Circular plasmid | 2,686 bp | 1,659,677 | 0.603 |
How to use this calculator
- Choose Sequence, or Length only for a long PCR product or plasmid.
- Paste the DNA sequence with A, C, G, and T.
- Select single-stranded, double-stranded, or circular.
- Select the 5' end for linear DNA, then calculate.
Formula and variables
MW = Σ(nᵢ × residueᵢ) + end group
| Symbol | Meaning | Unit |
|---|---|---|
| nᵢ | number of each nucleotide | count |
| residueᵢ | deoxynucleotide residue mass | g/mol |
| end group | 5' and 3' end groups | g/mol |
Worked example
The 5'-OH single strand ACGT has residues 313.210 + 289.184 + 329.209 + 304.195 = 1235.798 g/mol. The −61.964 end group gives 1173.834 g/mol.
Interpretation
The result is the neutral free-acid form. Sodium salts, modified bases, and dye labels change the mass.
Common mistakes
- Use T, not U, for thymine in DNA.
- Select double-stranded or circular for PCR products and plasmids.
- Select the 5' end that matches how the DNA was made.
Frequently asked questions
How do you calculate DNA molecular weight?
Add the residue mass of each nucleotide, then add the end groups. For double-stranded DNA, add the complementary strand too.
What is the average molecular weight of a DNA base pair?
It is about 617.8 g/mol per base pair in the free-acid form. Sodium salts are about 650 g/mol per base pair.
How do I calculate the molecular weight of a plasmid?
Select double-stranded circular and enter the length in base pairs. A circular molecule has no free ends.
How do I convert micrograms of DNA to picomoles?
Multiply the mass in micrograms by 1,000,000. Then divide by the molecular weight in g/mol.
Why is the GC content shown?
GC content affects the melting temperature of primers and probes. It is the percentage of G and C bases.
Can I use scientific notation?
Yes. Enter values such as 6.022e23 or 1.0e-6 in a numeric field.
How should I round the result?
Keep extra digits during the calculation. Round the final result to the precision required by your data.